CURRENT MICROBIOLOGY Vol. 51 (2005), pp. 211–216DOI: 10.1007/s00284-004-4430-4
CurrentMicrobiologyAn International Journalª Springer Science+Business Media, Inc. 2005
PCR Detection of Oxytetracycline Resistance Genes otr(A) and otr(B) inTetracycline-Resistant Streptomycete Isolates from Diverse Habitats
Theodora L. Nikolakopoulou,1 Sharon Egan,2 Leo S. van Overbeek,3 Gilliane Guillaume,4 Holger Heuer,5 Elizabeth M.H. Wellington,2 Jan Dick van Elsas,3 Jean-Marc Collard,4 Kornelia Smalla,5 Amalia D. Karagouni1
1National and Kapodistrian University of Athens, Faculty of Biology, Department of Botany, Microbiology Group, 157 81 Athens, Greece2University of Warwick, Department of Biological Sciences, Coventry CV4 7AL, United Kingdom3Biological Centre, Department of Microbial Ecology, Groningen University, P.O. BOX 14, 9750 AA Haren, The Netherlands4Scientific Institute of Public Health, Rue Juliette Wytsmanstraat 14, B-1050, Brussels, Belgium5Federal Biological Research Centre for Agriculture and Forestry (BBA), Messeweg 11-12, 38104 Braunschweig, Germany
Received: 4 August 2004 / Accepted: 4 September 2004
Abstract. A range of European habitats was screened by PCR for detection of the oxytetracyclineresistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolatesfrom environmental samples. Samples were obtained from bulk and rhizosphere soil, manure, activatedsludge and seawater. The majority of TcR streptomycetes originated from bulk and rhizosphere soil. Fewer TcR streptomycetes were isolated from manure and seawater and none from sewage. By PCR,three out of 217 isolates were shown to contain the otr(A) gene and 13 out of 217 the otr(B) gene. Surprisingly, these genes were detected in taxonomic groups not known as tetracycline-producingstrains. The majority of the otr gene–carrying strains was assigned to S. exfoliatus or S. rochei andoriginated from all habitats from which TcR streptomycetes were obtained. Our results indicated that theoccurrence of otr(A) and otr(B) genes in natural environments was limited and that otr(B), in com-parison to otr(A), seemed to be more common.
Keywords: tetracycline resistance genes, antibiotics, otr(A), otr(B), streptomycetes, PCR detection.
Tetracyclines are clinically important drugs and the
bacterium fortuitum and M. peregrinum, as well as
development and spread of resistance remains a major
pathogenic streptomycetes [18]. So far, tetracycline
concern. Of particular interest are the natural reser-
resistance in naturally occurring streptomycetes has
voirs of such resistance genes. Recent studies have
attempted to evaluate the impact of tetracycline use on
In this study, we assessed the prevalence of the two
communities of Gram-negative [1, 14] and Gram-po-
oxytetracycline resistance genes, otr(A) and otr(B),
sitive bacteria [2, 22] in various natural environments.
found on the chromosome of oxytetracycline producer
Reports on the presence of tetracycline resistance
Streptomyces rimosus, in streptomycete populations of
genes in streptomycetes are limited to the producer
environmental samples [7, 16]. The habitats selected
strains, such as Streptomyces rimosus [3] and S. au-
represented sites with either a history of pollution or
reofaciens [4], selected non-producing species such as
antibiotic selective pressure or more pristine environ-
Streptomyces lividans 1326 [5] and pathogenic ac-
ments and comprised of bulk and rhizosphere soil, sea-
tinomycetes with clinical importance, such as Myco-
water, manure, and sewage. In a comprehensive surveyof the occurrence of antibiotic resistance genes and their
mobility, the same samples were analysed using a
Present address: Department of Biological Sciences, University of
multiphasic approach for antibiotic resistance genes
Idaho, Moscow, ID 83844-3051, USACorrespondence to: Amalia D. Karagouni; email: akar@biol.uoa.gr
typically found in non-producing bacteria [12, 24].
Table 1. Streptomycetes and plasmids used in this study
Table 2. Origin of environmental samples that were studied
Description and origin of sample (Sample No)
Dossenheim (Germany); plantomycin (active compound streptomycin sulphate) treated soil (1)Dossenheim; untreated soil (2)Drotwichn (UK), sewage sludge treated soil (3)Costwolds (UK); limestone-based soil fallow (sparse vegetative cover) (4)
Dossenheim, grass grown on plantomycin (active compound streptomycin) treated soil (5)Dossenheim; grass grown on untreated soil (6)Ens (The Netherlands); white radish (Raphanus sativus L. rettich) grown on CuSO4 treated soil (7)Ens; white radish (R. sativus L. rettich) grown on untreated soil (8)
Broiler chicken grown on flavomycin-treatcd food (Germany) (9)Broiler chicken grown on untreated food (Germany) (10)Layer chicken grown on Zn-bacitracin-treated food (Germany) (11)Layer chicken grown on untreated food (Germany) (12)
Brussels; Hospital wastewater treatment facility (Erasmus Hospital; Belgium) (13)Ghent; Hospital wastewater treatment facility (Maria Middelares Hospital; Belgium) (14)Wavre; treatment plant of the Dyle valley (population, industry, university; Belgium) (15)Rosire; treatment plant of Lasne (population, industry, Belgium) (16)
Athens; wastewater treatment outflow in Saronicos Gulf (Greece) (17)Volos, Pagasiticos Gulf; fishfarm tetracycline administered at regular base (Greece) (18)Eretria (Evia Island): pristine (Greece) (19)Fleves Island; pristine (Greece) (20)
Serial dilutions (100 to 10–6) were plated on the streptomycete selectivemedia RASS and AGS [9], supplemented with 10 lg mL)1 tetracycline
Bacterial strains and culture conditions. Streptomycetes and E. coli
and 100 lg mL)1 cycloheximide, to inhibit fungal growth and
strains carrying tetracycline resistance genes were used in this study
incubated at 28°C for 3 to 10 days. Colonies with different color and
(Table 1). These strains were grown on Tryptic Soy Agar (TSA,
morphology (maximally 24 individual colonies from each sample)
Oxoid) and Luria Agar (Oxoid), respectively, amended with 50 lg
were purifired and spore suspensions of isolates were stored in 20%
mL)1 of tetracycline at 27°C. Strains of S. griseus, S. coelicolor and S.
fradiae with phenotypes sensitive to tetracycline were also employedand were grown on TSA at 27°C.
Denaturing Gradient Gel Electrophoresis (DGGE). The 16S rRNAgene–based PCR-DGGE method, as described by Heuer et al. [11], was
Sampling and selective isolation of TcR streptomycetes. Twenty
applied to all TcR streptomycete isolates obtained. For this purpose,
European sampling sites were selected and samples were taken from
genomic DNA was extracted from streptomycete isolates, using a
bulk soil, rhizosphere soil, manure, activated sludge and seawater
protocol described by Hopwood et al. [13] and subjected to
(Table 2). The sampling sites and the sample processing methodology
amplification using the actinomycete specific primers F243 and
have been described in detail by Heuer et al. [12] and van Overbeek
R513gc [11]. Amplicon profiles from all isolates were used in order
et al. [24]. Sampling from four different locations for each habitat gave
to cluster isolates into groups and reduce the number of isolates used
the opportunity to include two samples from habitats under selective
for further identification analysis, by selecting only representatives
pressure, for example, pollution, heavy metals or antibiotic treatments
from each one of the assigned groups.
and two samples from sites that were not known to be receivingtreatments. Bacterial suspensions of all samples were placed in a water
Characterization of culturable resistant phenotypes. Identification
bath for 2 h at 60°C to eliminate the growth of other bacterial groups
of isolates was carried out using 41 morphological and physiological
and to enhance the possibility of heat-tolerant streptomycetes to grow.
diagnostic characters for phenotypic identification [15]. Isolates were
T.L. Nikolakopoulou et al.: Distribution of Oxytetracycline Resistance
identified using the probabilistic identification matrix of Williams etal. [25]. In this scheme, three identification statistics were used: theWilcox probability, taxonomic distance and its standard deviation [25].
Primer design and PCR detection of otr genes. PCR technique wasemployed to detect otr(A) and otr(B) gene sequences among the TcRstreptomycetes isolated in this study. Selected PCR primer sets weretested for amplification of their respective target genes. They were alsoassessed for the absence of any PCR product when targetingtetracycline-sensitive
containing tetracycline resistance genes (Table 1), non-homologousto otr genes. Genomic DNA was extracted from streptomycete isolates,as described by Hopwood et al. [13] and plasmid DNA was extractedfrom the TcR E. coli reference strains according to a standard protocol[21]. PCR amplification was performed in a Thermal Cycler (Genius,Techne, Cambridge, UK), and the reaction mixture was as follows:Tris-HCl pH 8.3, 50 mM; KCl 50 mM; MgCl2 2.5 mM; 0.1 mg mL)1bovine serum albumin (Sigma); 200 lM of each deoxynucleoside
Fig. 1. DGGE analysis of 16S rRNA gene amplicons from TcR
triphosphate; 2.5 % dimethyl sulfoxide; 100 nM of each oligo; 1 U of
streptomycete isolates. Lanes 2, 4, 5, 8: amplicons from strains that
TaqPolymerase (Promega, Madison, WI) and 1 lL (ca. 20 ng) of
belong to group B; lanes 1, 3, 6, 7, 9, 10, 11: amplicons from strains of
template DNA. Amplified fragments were resolved by agarose gel (1%)
groups A, C, D, E, F, G respectively.
electrophoresis in TBE buffer followed by ethidium bromide staining.
Southern blot analysis of otr(A) and otr(B). PCR-amplified otr(A)
tification results of all representatives from each group
and otr(B) fragments were confirmed by Southern blot assays [10].
were alike. This analysis revealed the presence of 58 S.
Amplicons in agarose gels were transferred onto nylon membranes
exfoliatus isolates (group A), 14 S. albidoflavus (group
(Nytran SuperCharge, Schleicher & Schuell, Germany). Membranes
B) and 30 S. viridosporus isolates (group C) and 42
were hybridized by digoxigenin-labelled DNA probes (Roche,
isolates that could not be identified (Group D) in bulk
Mannheim, Germany) generated by PCR amplification of otr(A) andotr(B) from S. rimosus ATTC 10970. Southern hybridization signals of
soil samples. Seven isolates originating from the
PCR products were detected using the DIG detection kit (Roche).
rhizosphere soil samples belonged to S. rochei cluster(group E) and 14 isolates to S. albidoflavus cluster
Cloning and sequencing. PCR products obtained with otr(A) andotr(B) primers were ligated into the pCR 2.1 TOPO vector according to
(group B). Isolates of group F, which were identified as
the instructions of the manufacturer (Invitrogen, La Jolla, CA). After
S. collinus strains, were found in both manure (21
transformation of TOPO10F competent cells (Invitrogen), clones were
isolates) and seawater (five isolates) samples, whilst 15
picked and the presence of inserts of the expected size was assessed.
manure isolates belonging to group A were chara-
Selected clones were then sequenced with vector-specific primers on a
cterized as S. exfoliatus strains. Eight of the marine TcR
PE-ABI377 sequencer (IMBB, Crete, Greece).
streptomycete strains were identified as S. rochei (groupE) and there were three marine isolates (group G) that
Characterization of TcR streptomycete isolates. From
all environmental samples, 217 TcR Streptomyces
primers. Primers were designed for the detection of
colonies were isolated. Out of these isolates, 66%
otr(A) and otr(B)-like genes in streptomycetes (Table 3).
originated from bulk soil, 9.6% were isolates from
The rationale of primer design was to specifically target
rhizosphere soil samples, 16% were from manure
the otr(A) and otr(B) genes found in S. rimosus, but also
and 7.3% from seawater samples. Interestingly, no
to amplify the homologous to otr(A) tetracycline resis-
streptomycete growth was observed on plates inoculated
tance gene tet found in the non-producer S. lividans and
with activated sludge samples. All isolates were
the trc3 gene found in the chlortetracycline producer S.
screened by analysis of 16S rRNA gene amplicons by
aureofaciens, which is homologous to otr(B) (Table 1).
denaturing gradient gel electrophoresis. The band
Control PCR tests were performed with E. coli strains
position of isolates was examined and strains were
carrying plasmids with other known TcR genes, non-
assigned to seven migration groups based on the final
homologous to otr genes. The absence of signals
position in the gel (Fig. 1). Groups were not unique for
indicated that the selected primers did not amplify TcR
the samples. Four of the seven groups had isolates
genes distant to the otr genes found in streptomycete
originating from different samples. Randomly, ten
strains. PCR products, of 778 bp for the otr(A) amplicon
representatives from each of the groups (where a
and 947 bp for the otr(B) amplicon, both amplified from
group contained more than ten isolates) were selected
S. rimosus were cloned and sequenced, to verify the
and were further characterized phenotypically. Iden-
specificity of the primers. Alignment of sequences
Table 3. PCR primers, cycles of amplification, primer position and sizes of amplified DNA fragments of this study
GAACACGTACTGACCGAGAAG 4 min/94°C, 35 · (1 min/94°C,
1 min/55°C, 2 min/72°C) and10 min/72°C
CCGACATCTACGGGCGCAAGC 4 min/94°C, 35 · (1 min/94°C,
1 min/55°C, 2 min/72°C) and10 min/72°C
a Genbank accession number and strain on which primers were based. b Forward primer. c Reverse primer.
Table 4. Streptomycete hosts of otr genes isolated from different environmental samples
showed 100% similarity to the published sequences of
detected in thirteen isolates: five S. exfoliatus from
the respective genes from S. rimosus. No amplification
Cotswold soil and antibiotic treated broiler chicken
product was observed in PCR tests with chromosomal
manure, five S. rochei isolated from rhizosphere soil
DNA from tetracycline-sensitive streptomycete strains
(untreated Ens site) and seawater (fishfarm and Evia
such as S. griseus, S. coelicolor and S. fradiae.
Island), two S. viridosporus isolates from Dossenheimsoil and one S. albidoflavus from Cotswold soil and
Distribution of otr determinants within strepto-
(Table 4). The presence of the otr genes was confirmed
mycete isolates. All 217 TcR streptomycetes were
by sequencing the amplicons obtained from isolates.
analyzed for the presence of otr genes using PCR
Comparison of these sequences showed that all three
followed by hybridization with the appropriate probe.
otr(A)-amplicons and twelve otr(B)-amplicons were
Only 15 isolates, obtained from dilution plates not
100% identical with the respective sequenced otr
higher than 10)2, showed signals with any one of the
probes, and one (S. rochei ER2 of marine origin) gave
showed 92% similarity to the S. rimosus otr(B) gene
positive hybridization with both probes. The otr(A) gene
was detected in two isolates from the Dossenheim soilsamples identified as S. exfoliatus and S. viridosporus,
and in one S. rochei strain from the seawater samplefrom Evia Island (Table 4). None of the rhizosphere soil
This work is, to the best of our knowledge, the first
or manure isolates carried otr(A). The otr(B) gene was
attempt to study tetracycline resistance and to estimate
T.L. Nikolakopoulou et al.: Distribution of Oxytetracycline Resistance
the gene pool and flux of resistance genes in environ-
Interestingly, most otr amplicons from the isolates
mental streptomycetes. TcR streptomycetes were found
shared 100% sequence identity with the sequences of otr
in all samples, with the exception of sewage that pro-
genes found in S. rimosus. The occurrence of identical
vided no isolates. Although the taxonomic composition
tetracycline resistance genes in different streptomycete
varied among the environmental samples, only seven
hosts provides additional support for the idea that hori-
different streptomycete groups were found based on
zontal gene transfers are the main events that help active
DGGE analysis. An interesting observation was the
exchange of such genes within the Streptomyces cluster
absence of tetracycline-producing strains, such as S.
rimosus and S. aureofaciens, among the TcR isolates.
In this study, we provided more information on the
This is in contrast with the findings of Egan and
occurrence of tetracycline resistance genes otr(A) and
coworkers [8] and Tolba and co-workers [23]. They
otr(B) in a collection of streptomycete isolates from
showed the majority of the streptomycin-resistant
different environmental samples. Although previous
streptomycetes isolated from soil samples were identi-
studies [22] have addressed the prevalence of specific
fied as S. griseus, a streptomycin-producing strain.
antibiotic resistances in the environment, none of the
The present study indicated that only a small pro-
studies on tetracycline resistance included streptomycete
portion (7%) of the streptomycete isolates screened,
populations in their investigations. The observation that
with phenotypic resistance to tetracycline, contained
tetracycline resistance was present in the apparent ab-
otr(A) or otr(B). This is not the only case that pheno-
sence of antibiotic selective pressure (bulk and rhizo-
typically TcR isolates did not hybridize with any of the
sphere soil, manure and seawater samples that have no
tet probes studied [3]. This could imply that some of the
obvious tetracycline contamination but carry strepto-
isolates may carry tet genes that were not screened in
mycetes with otr(A) and otr(B) genes) raises the ques-
this study. For example, tet(K) and tet(L) genes are
tion of how resistance persists. A recent study suggested
widely distributed among Gram-positive species and
that bacteria may have been able to adapt to the load of
have been found in Mycobacterium, Nocardia and
carrying resistance with little or no cost to their fitness
Streptomyces spp. isolated from humans [6, 18]. How-
[17]. In this scenario, the antibiotic-resistant microbiota
ever it is shown that not all TcR Gram-positive bacteria
would successfully compete with the sensitive pheno-
have been reported to carry specific known tet genes
types even in the absence of selection, which would
make control of antibiotic resistance even more difficult.
The isolates that contained otr genes were taxo-
nomically grouped within a range of four streptomycete
taxa: S. exfoliatus, S. rochei, S. viridosporus and S. albidoflavus, which are not known to produce tetracy-
This study was financially supported by EU-BIOTECHgrant BIO4-CT98-0054 (RESERVOIR) and the European Union-funded Concerted
clines. Out of these four groups, S. rochei and S. exfo-
Action MECBAD (BIO4-CT98-0099). We are grateful to the President
liatus could be considered the main reservoirs of the
of the National Center of Marine Research, Dr. G. Chronis, and all the
otr(A) and otr(B) genes in the screened habitats. Isolates
researchers of the oceanographic ship ‘‘AGAIO’’ for assistance in the
that hybridized with the otr probes were obtained not
only from polluted habitats, but also from environmentswith limited or no obvious antibiotic selective pressure
such as untreated bulk and rhizosphere soils. Our data
1. Aminov RI, Chee-Sanford JC, Garrigues N, Teferedegne B, Kra-
showed that otr(B) gene was more frequently detected in
pac IJ, White BA, Mackie RI (2002) Development, validation, andapplication of PCR primers for detection of tetracycline efflux
the samples than otr(A) gene. This could imply that the
genes of gram-negative bacteria. Appl Environ Microbiol
efflux mechanism for resistance to tetracycline in
streptomycete populations is dominant over the ribo-
2. Aminov RI, Garrigues-Jeanjean N, Mackie RI (2001) Molecular
somal protection mechanism. An interesting property of
ecology of tetracycline resistance: Development and validation of
ribosomal protection is that it does not normally confer
primers for detection of tetracycline resistance genes encodingribosomal protection proteins. Appl Environ Microbiol 76:22–23
high-level tetracycline resistance, as compared to the
3. Chopra I, Roberts MC (2001) Tetracycline antibiotics: mode of
efflux genes, when cloned into E. coli. Thus, the ribo-
action, applications, molecular biology and epidemiology of bac-
somal protection mechanism of resistance might not
terial resistance. Microbiol Mol Bio Rev 65:232–260
provide much survival value in the presence of tetra-
4. Dairi T, Aisaka K, Katsumata R, Hasegawa M (1995) A self-
cycline in nature for the enteric bacteria [19]. However,
defense gene homologous to tetracycline effluxing gene essentialfor antibiotic production in Streptomyces aureofaciens. Biosci
there is no information available referring to levels of
resistance that ribosomal protection mechanisms confer
5. Ditrich W, Schrempf H(1992) The unstable tetracycline resistance
to Streptomyces sp. to support this idea.
gene of Streptomyces lividans 1326 encodes a putative protein
with similarities to translational elongation factors and TetM and
15. Katsifas EA, Giannoutsou EP, Karagouni AD (1999) Diversity of
TetO proteins. Antimicrob Agents Chemother 36:1119–1124
streptomycetes among specific Greek terrestrial ecosystems. Lett
6. Doran JL, Pang Y, Mdluli KE, Moran AJ, Victor TC, Stokes RW,
van Helden E, Roberts MC, Nano FE (1997) Mycobacterium
16. McMurry LM, Levy SB (1998) Revised sequence of Otr(B)
tuberculosis efpA encodes and efflux protein of the QacA trans-
(Tet347) tetracycline efflux protein from Streptomyces rimosus.
porter family. Clin Diagn Lab Immunol 4:23–32
7. Doyle D, McDowell KJ, Butler MJ, Hunter IS (1991) Character-
17. Morris A, Kellner JD, Low DE (1998) The superbugs: evolution,
ization of an oxytetracycline-resistance gene, otrA, of Streptomy-
dissemination and fitness. Curr Opin Microbiol 1:526–529
18. Pang Y, Brown BA, Steingrube VA, Wallace RJ, Roberts MC
8. Egan S, Wiener P, Kallifidas D, Wellington EMH(1998)
(1994) Tetracycline resistance determinants in Mycobacterium and
Transfer of streptomycin biosynthesis gene clusters within strep-
Streptomyces species. Antimicrob Agents Chemother 38:1408–
tomycetes isolated from soil. Appl Environ Microbiol 64:5061–
19. Rhodes G, Huys G, Swings J, McGann P, Hiney M, Smith P,
9. Egan S, Wiener P, Kallifidas D, Wellington EMH(2001) Phy-
Pickup RW (2000) Distribution of oxytetracycline resistance
logeny of Streptomyces species and evidence for horizontal
plasmids between aeromonads in hospital and aquaculture envi-
transfer of entire and partial antibiotic gene clusters. Ant Van
ronments: implication of Tn1721 in dissemination of the tetracy-
cline resistance determinant tetA. Appl Environ Microbiol
10. Gçtz A, Pukall R, Smit E, Tietze E, Prager R, Tschäpe H, van
Elsas JD, Smalla K (1996) Detection and characterization of
20. Roberts MC, Moncla BJ, Hillier SL (1991) Characterization of
broad-host range plasmids in environmental bacteria by PCR.
unusal tetracycline-resistant gram-positive bacteria. Antimicrob
11. Heuer H, Krsek M, Baker P, Smalla K, Wellington EM (1997)
21. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a
Analysis of actinomycete communities by specific amplification
laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold–Spring
of genes encoding 16S rRNA and gel-electrophoretic separation
in denaturing gradients. Appl Environ Microbiol 63:3233–
22. Seveno N, Smalla K, van Elsas JD, Collard J-M, Karagouni A,
Kallifidas D, Wellington EMH(2002) Occurrence and reservoirs
12. Heuer H, Krçgerrecklenfort E, Wellington EMH, Egan S, van
of antibiotic resistance genes in the environment. Rev Med
Elsas JD, van Overbeek L, Collard J-M, Guillaume G, Karagouni
AD, Nikolakopoulou TL, Smalla K (2002) Gentamicin resistance
23. Tolba S, Egan S, Kallifidas D, Wellington EMH(2002) Distri-
genes in environmental bacteria: prevalence and transfer. FEMS
bution of streptomycin resistance and biosynthesis genes in
streptomycetes recovered from different soil sites. FEMS Micro-
13. Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton CJ, Kieser
HM, Lydiate DJ, Smith C, Ward JM, Schrempf H (1985) Genetic
24. van Overbeek LS, Wellington EMH, Egan S, Smalla K, Heuer H,
manipulation of Streptomyces, a laboratory manual, 1st edn., Vol
Collard J-M, Guillaume G, Karagouni AD, Nikolakopoulou TL,
van Elsas JD (2002) Prevalence of streptomycin-resistance genes
14. Huys G, Rhodes G, McGann P, Denys R, Pickup R, Hiney M,
in bacterial populations in European habitats. FEMS Microbiol
Smith P, Swings J (2000) Characterization of oxytetracycline-
resistant heterotrophic bacteria originating from hospital and
25. Williams ST, Goodfellow M, Wellington EMH(1983) A proba-
freshwater fishfarm environments in England and Ireland. Syst
bility matrix for identification of some streptomycetes. J Gen
Clinical Chemistry 50:91650 –1655 (2004)Hyperaldosteronism: Ratio of Plasma Aldosteroneto Renin Concentration Determined by FullyFrank Holger Perschel,1* Rudolf Schemer,3 Lysann Seiler,4 Martin Reincke,4Jaap Deinum,5 Christiane Maser-Gluth,6 David Mechelhoff,1 Rudolf Tauber,1 and Background: The ratio of plasma aldosterone concen- between 298 and 6756 (pmol/L)/(ng ⅐ mL ؊ 1
I. Listening comprehension: Teenage rebellion (3.21 min)Vocabulary:transgressions - wrong doingsstay over - spend the nightleft to their own devices - they could do what they wantedhaving the time of their lives - having a marvellous timea terrific row - a big argumenta sick note - a note from parents saying that their child is too ill to go to schooloutlandish - strange, exoticno big deal - noth